The detailed information of tRNA gene sequence


Sequence ID>W1910716637
Genome IDMFWP01000002
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_19FT_COMBO_34_9 (MFWP)
Start position on genome 56820
End posion on genome 56892
Amino Acid Thr
Anticodon CGT
Upstream region at tRNA start position
tctaattatt
tRNA gene sequence
GCCCCAATAGCTCAGTTGGCAGAGCATCACTTTCGTAAAGTGGGTGTCGGGAGTTCAAAT
CTCTCTTGGGGCTtag
Downstream region at tRNA end position
aattatttct
Secondary structure (Cloverleaf model)
>W1910716637	Thr	CGT
                   t      Ttag aattatttct
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     A - T
                     A - T          T A
                    T     C T C T C     A
      T G A        A      | + | | |     A
    T       C T C G       G G G A G     C
    G       | | | |                 T T
    G       G A G C
      C A          A     GTGTC
                    T + G
                    C - G
                    A - T
                    C - G
                    T - A
                  T       A
                  T       A
                    C G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK