The detailed information of tRNA gene sequence


Sequence ID>W1910716638
Genome IDMFWP01000002
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_19FT_COMBO_34_9 (MFWP)
Start position on genome 55468
End posion on genome 55383
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
tttttaataT
tRNA gene sequence
GCGGGTGTGCCAGAGTGGTCAAATGGGTAGGACTTAAGATCCTATGGCTTAGTGCCTTCG
AAGGTTCGAATCCTTTCACCCGCATta
Downstream region at tRNA end position
ttctgttgaa
Secondary structure (Cloverleaf model)
>W1910716638	Leu	TAA
                   T      ATta ttctgttgaa
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T A
                    T     T T T C C     A
      T G A        G      + | | | |     G
    G       G A C C       G A A G G     C
    G         | | |                 T T
    T       A T G G
      C A A        G     TGGCTTAGTGCCTTC
                    T - A
                    A - T
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK