The detailed information of tRNA gene sequence


Sequence ID>W1910716645
Genome IDMFWP01000007
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_19FT_COMBO_34_9 (MFWP)
Start position on genome 677
End posion on genome 752
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
ataatgttaT
tRNA gene sequence
GGCTCCGTAGCTCAGCCTGGTAGAGCACTGGACTTTTAATCCAGGTGTCGCGGGTTCAAA
TCCCGTCGGGGCCATga
Downstream region at tRNA end position
atgattgaat
Secondary structure (Cloverleaf model)
>W1910716645	Lys	TTT
                   T      ATga atgattgaat
                     G - C
                     G - C
                     C - G
                     T + G
                     C - G
                     C - G
                     G - C          T A
                    T     T G C C C     A
      C G A        A      + | | | |     A
    C       C T C G       G C G G G     C
    T       | | | |                 T T
    G       G A G C
      G T A        A     GTGTC
                    C - G
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK