The detailed information of tRNA gene sequence


Sequence ID>W1910716646
Genome IDMFWP01000009
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_19FT_COMBO_34_9 (MFWP)
Start position on genome 40490
End posion on genome 40563
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
gttatttatT
tRNA gene sequence
GGCTGCATAGCTCAGTGGTAGAGCACGAGTCTCATGAGCTCGGGGTCCTGGGTTCAACTC
CCAGTGCAGCCATaa
Downstream region at tRNA end position
atccttcaaa
Secondary structure (Cloverleaf model)
>W1910716646	Met	CAT
                   T      ATaa atccttcaaa
                     G - C
                     G - C
                     C - G
                     T - A
                     G - C
                     C - G
                     A - T          T C
                    T     G A C C C     A
        G A        A      | | | | |     A
      T     C T C G       C T G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        A     GGGTC
                    C - G
                    G - C
                    A - T
                    G - C
                    T + G
                  C       A
                  T       G
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK