The detailed information of tRNA gene sequence


Sequence ID>W1910716647
Genome IDMFWP01000012
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_19FT_COMBO_34_9 (MFWP)
Start position on genome 185
End posion on genome 255
Amino Acid Ala
Anticodon TGC
Upstream region at tRNA start position
atttatttaa
tRNA gene sequence
GGGCCCGTAGTCCAACGGCAGAATACCTCGCTTGCACCGAGGAGTTCCGAGTTCAATTCT
CGGCGGGTCCAttc
Downstream region at tRNA end position
gagcaatttc
Secondary structure (Cloverleaf model)
>W1910716647	Ala	TGC
                   a      Attc gagcaatttc
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C          T T
                    T     G G C T C     A
        A A        A      | | | | |     A
      C     C C T G       C C G A G     C
      G     |   | +                 T T
      G     G A A T
        C A        A     AGTT
                    C - G
                    C - G
                    T - A
                    C - G
                    G - C
                  C       C
                  T       A
                    T G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK