The detailed information of tRNA gene sequence


Sequence ID>W1910716649
Genome IDMFWP01000013
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_19FT_COMBO_34_9 (MFWP)
Start position on genome 26870
End posion on genome 26943
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
acgcaaaatT
tRNA gene sequence
GCTCACTTGGTCTAACGGCTATGACATATCCCTGTCACGGATATAACCCGAGTTCGACTC
TCGGAGTGGGCGTtt
Downstream region at tRNA end position
ctattctatg
Secondary structure (Cloverleaf model)
>W1910716649	Asp	GTC
                   T      GTtt ctattctatg
                     G - C
                     C - G
                     T + G
                     C - G
                     A - T
                     C - G
                     T - A          T C
                    T     G G C T C     A
      C A A        G      | | | | |     G
    G       T C T G       C C G A G     C
    G         | | |                 T T
    C       T G A C
      T A          A     TAAC
                    T - A
                    A - T
                    T - A
                    C - G
                    C - G
                  C       C
                  T       A
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK