The detailed information of tRNA gene sequence


Sequence ID>W1910716650
Genome IDMFWP01000013
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_19FT_COMBO_34_9 (MFWP)
Start position on genome 44642
End posion on genome 44572
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
agattactaa
tRNA gene sequence
GGTCCTTTAGTCTATCGGTAGAACACCTCGTTTACACCGAGGAAGGGGAGGTTCGACTCC
TCCAAGGACCAtat
Downstream region at tRNA end position
gctcgcttga
Secondary structure (Cloverleaf model)
>W1910716650	Val	TAC
                   a      Atat gctcgcttga
                     G - C
                     G - C
                     T - A
                     C - G
                     C - G
                     T - A
                     T - A          T C
                    T     C C T C C     A
        T A        A      | | | | |     G
      C     T C T G       G G A G G     C
      G     +   | |                 T T
      G     G A A C
        T A        A     AAGG
                    C - G
                    C - G
                    T - A
                    C - G
                    G - C
                  T       C
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK