The detailed information of tRNA gene sequence


Sequence ID>W1910716651
Genome IDMFWP01000013
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon RBG_19FT_COMBO_34_9 (MFWP)
Start position on genome 34444
End posion on genome 34374
Amino Acid Tyr
Anticodon GTA
Upstream region at tRNA start position
ttggctttag
tRNA gene sequence
CCCCTCATAGCATAGTGGTAATGCAGTCGGCTGTAGACCGGCGTATCCAAGTTCGATTCT
TGGTGGGGGGAtat
Downstream region at tRNA end position
tccggaatta
Secondary structure (Cloverleaf model)
>W1910716651	Tyr	GTA
                   g      Atat tccggaatta
                     C - G
                     C - G
                     C - G
                     C - G
                     T + G
                     C - G
                     A - T          T T
                    T     G G T T C     A
        G A        A      | | | | |     G
      T     T A C G       C C A A G     C
      G     | | | |                 T T
      G     A T G C
        T A        A     GTAT
                    G - C
                    T + G
                    C - G
                    G - C
                    G - C
                  C       A
                  T       G
                    G T A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK