The detailed information of tRNA gene sequence


Sequence ID>W1910717029
Genome IDMFXR01000008
Search identical group
Phylum/ClassCandidatusPeregrinibacteria
SpeciesCandidatus Peribacteria bacterium RIFCSPHIGHO2_01_FULL_54_22 (MFXR)
Start position on genome 21466
End posion on genome 21390
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
ccacatgcat
tRNA gene sequence
GCGGATGTAGCTCAGTTGGCTAGAGCGTCGCCTTGCCAAGGCGAAGGTCGCGGGTTCGAA
CCCCGTCATCCGCTCCA
Downstream region at tRNA end position
agatgcgcat
Secondary structure (Cloverleaf model)
>W1910717029	Gly	GCC
                   t      TCCA agatgcgcat
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          C A
                    T     T G C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G C G G G     C
    G       | | | |                 T T
    G       G A G C
      C T A        G     AGGTC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  T       A
                  T       A
                    G C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK