The detailed information of tRNA gene sequence


Sequence ID>W1910726104
Genome IDMGRB01000011
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDeltaproteobacteria bacterium RBG_19FT_COMBO_46_9 (MGRB)
Start position on genome 232
End posion on genome 157
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
cgttttgaag
tRNA gene sequence
GCGGGCATAGCTCAGTTGGTAGAGTACAAGCTTCCCAAGCTTGGTGTCGCGGGTTCGAAC
CCCGTTGCCCGCTCCA
Downstream region at tRNA end position
aggatttgag
Secondary structure (Cloverleaf model)
>W1910726104	Gly	CCC
                   g      TCCA aggatttgag
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     C - G
                     A - T          C A
                    T     T G C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G C G G G     C
    G       | | | +                 T T
    G       G A G T
      T A          A     GTGTC
                    C - G
                    A - T
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK