The detailed information of tRNA gene sequence


Sequence ID>W1910765750
Genome IDMNVV01000002
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 1081
End posion on genome 1155
Amino Acid Gln
Anticodon CTG
Upstream region at tRNA start position
aaagagtttT
tRNA gene sequence
AGCCCCATCTTCCAGCGGTCAAGGAAACGGGACTCTGGATCCCGTAACCCAGGTTCGAAT
CCTGGTGGGGCTATtt
Downstream region at tRNA end position
tttagcaaaa
Secondary structure (Cloverleaf model)
>W1910765750	Gln	CTG
                   T      ATtt tttagcaaaa
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     A - T          T A
                    T     G G T C C     A
      C G A        C      | | | | |     G
    G       C C T T       C C A G G     C
    G       | | | |                 T T
    T       G G A A
      C A A        A     TAAC
                    C - G
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    C T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK