The detailed information of tRNA gene sequence


Sequence ID>W1910765752
Genome IDMNVV01000010
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 34720
End posion on genome 34791
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
tcattcatag
tRNA gene sequence
GCTCACATGGTCTAACGGTTATGACACTAGCCTGTCGCGCTGGAAACCCGGGTTCGACTC
CCGGTGTGGGCGtat
Downstream region at tRNA end position
tttgtgtaac
Secondary structure (Cloverleaf model)
>W1910765752	Asp	GTC
                   g      Gtat tttgtgtaac
                     G - C
                     C - G
                     T + G
                     C - G
                     A - T
                     C - G
                     A - T          T C
                    T     G G C C C     A
      C A A        G      | | | | |     G
    G       T C T G       C C G G G     C
    G         | | |                 T T
    T       T G A C
      T A          A     AAAC
                    C - G
                    T + G
                    A - T
                    G - C
                    C - G
                  C       C
                  T       G
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK