The detailed information of tRNA gene sequence


Sequence ID>W1910765753
Genome IDMNVV01000010
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 18955
End posion on genome 18883
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
gtaggtttaT
tRNA gene sequence
GCGGAAATAGTTAAGTGGTAGAATATGACCTTGCCAAGGTTGTGACCCGGGTTCGATTCC
CGGTTTCCGCATtc
Downstream region at tRNA end position
tttatttttt
Secondary structure (Cloverleaf model)
>W1910765753	Gly	GCC
                   T      ATtc tttatttttt
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     A - T
                     A - T          T T
                    T     G G C C C     A
        G A        A      | | | | |     G
      T     A T T G       C C G G G     C
      G       | | +                 T T
      G     G A A T
        T A        A     TGAC
                    T + G
                    G + T
                    A - T
                    C - G
                    C - G
                  T       A
                  T       A
                    G C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK