The detailed information of tRNA gene sequence


Sequence ID>W1910765754
Genome IDMNVV01000012
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 15919
End posion on genome 16000
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
aataatagtT
tRNA gene sequence
GCCTCTGTCGCATAATGGTAGTGCACCGGACTTGAGATCCGGGCCCTTTGGGCTTCCAGG
TTCGATTCCTGGCGGGGGCGTtt
Downstream region at tRNA end position
tcttttaata
Secondary structure (Cloverleaf model)
>W1910765754	Ser	TGA
                   T      GTtt tcttttaata
                     G - C
                     C - G
                     C - G
                     T + G
                     C - G
                     T + G
                     G - C          T T
                    T     G G T C C     A
        A A        C      | | | | |     G
      T     T A C G       C C A G G     C
      G     + | | |                 T T
      G     G T G C
        T A        A     GCCCTTTGGGCTT
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK