The detailed information of tRNA gene sequence


Sequence ID>W1910765755
Genome IDMNVV01000012
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 24230
End posion on genome 24303
Amino Acid Phe
Anticodon GAA
Upstream region at tRNA start position
atttgataaT
tRNA gene sequence
GGGAATGTAGCTCAGCGGGAGAGCACATGACTGAAGATCATGGTGTCGGGGGTTCGACTC
CCCCCATTCCCATtt
Downstream region at tRNA end position
tcaacattct
Secondary structure (Cloverleaf model)
>W1910765755	Phe	GAA
                   T      ATtt tcaacattct
                     G - C
                     G - C
                     G - C
                     A - T
                     A - T
                     T - A
                     G - C          T C
                    T     C C C C C     A
        G A        A      | | | | |     G
      C     C T C G       G G G G G     C
      G     | | | |                 T T
      G     G A G C
        G A        A     GTGTC
                    C - G
                    A - T
                    T - A
                    G - C
                    A - T
                  C       A
                  T       G
                    G A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK