The detailed information of tRNA gene sequence


Sequence ID>W1910765756
Genome IDMNVV01000012
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 30893
End posion on genome 30964
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
atagatccaa
tRNA gene sequence
GCGTTAGTGGTCTAATGGTAGAATACGAGCTTCCCAAGCTTGTGATCCGGGTTCGATTCC
CGGCTGGCGCACtt
Downstream region at tRNA end position
ttttgtaact
Secondary structure (Cloverleaf model)
>W1910765756	Gly	CCC
                   a      ACtt ttttgtaact
                     G - C
                     C - G
                     G - C
                     T + G
                     T + G
                     A - T
                     G - C          T T
                    T     G G C C C     A
        A A        G      | | | | |     G
      T     T C T G       C C G G G     C
      G     +   | +                 T T
      G     G A A T
        T A        A     TGAT
                    C - G
                    G + T
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK