The detailed information of tRNA gene sequence


Sequence ID>W1910765757
Genome IDMNVV01000012
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 19176
End posion on genome 19104
Amino Acid Thr
Anticodon CGT
Upstream region at tRNA start position
gcttagctgt
tRNA gene sequence
GCCTCAGTAGCTCAGTTGGCAGAGTATTTGCTTCGTAAGCAAAGGGTCGGGGGTTCGACT
CCCCCCTGAGGCTttg
Downstream region at tRNA end position
gaataactat
Secondary structure (Cloverleaf model)
>W1910765757	Thr	CGT
                   t      Tttg gaataactat
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     A - T
                     G - C          T C
                    T     C C C C C     A
      T G A        A      | | | | |     G
    T       C T C G       G G G G G     C
    G       | | | +                 T T
    G       G A G T
      C A          A     GGGTC
                    T - A
                    T - A
                    T - A
                    G - C
                    C - G
                  T       A
                  T       A
                    C G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK