The detailed information of tRNA gene sequence


Sequence ID>W1910765758
Genome IDMNVV01000013
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 1585
End posion on genome 1659
Amino Acid Pro
Anticodon TGG
Upstream region at tRNA start position
atttaattaT
tRNA gene sequence
GGGGCTGTGGGGTAGCCTGGTAGCCTTAGAGGTTTGGGACCTCTCGACCCCGGTTCAAAT
CCGGGCAGCCCCATtt
Downstream region at tRNA end position
aaaaaaatga
Secondary structure (Cloverleaf model)
>W1910765758	Pro	TGG
                   T      ATtt aaaaaaatga
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     T - A
                     G - C          T A
                    T     G G G C C     A
      C G A        G      | | | | |     A
    C       T G G G       C C C G G     C
    T       + | | +                 T T
    G       G C C T
      G T A        T     CGAC
                    A - T
                    G - C
                    A - T
                    G - C
                    G - C
                  T       A
                  T       G
                    T G G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK