The detailed information of tRNA gene sequence


Sequence ID>W1910765759
Genome IDMNVV01000016
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 6611
End posion on genome 6683
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
atgtactatG
tRNA gene sequence
GTGGATGTAGTTTAATGGTAGAATGCACGGTTGTGGTCCGTGAGAAGCGAGTTCGATTCT
CGCTTTCCACCCta
Downstream region at tRNA end position
aatttaaaat
Secondary structure (Cloverleaf model)
>W1910765759	His	GTG
                   G      CCta aatttaaaat
                     G - C
                     T - A
                     G - C
                     G - C
                     A - T
                     T   T
                     G + T          T T
                    T     C G C T C     A
        A A        A      | | | | |     G
      T     T T T G       G C G A G     C
      G     + | | +                 T T
      G     G A A T
        T A        G     AGAA
                    C - G
                    A - T
                    C - G
                    G - C
                    G - C
                  T       T
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK