The detailed information of tRNA gene sequence


Sequence ID>W1910765761
Genome IDMNVV01000018
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 11897
End posion on genome 11825
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
aaatctataa
tRNA gene sequence
AGCCCCTTATTACAGTGGTCAAGTATGCAAGCCTTTGAAGCTTGAGACCCAGGTTCGAAT
CCTGGAGGGGCTAttg
Downstream region at tRNA end position
attcgaacta
Secondary structure (Cloverleaf model)
>W1910765761	Gln	TTG
                   a      Attg attcgaacta
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     T - A          T A
                    T     G G T C C     A
      T G A        A      | | | | |     G
    G       C A T T       C C A G G     C
    G       | | |                   T T
    T       G T A T
      C A A        G     AGAC
                    C - G
                    A - T
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK