The detailed information of tRNA gene sequence


Sequence ID>W1910765762
Genome IDMNVV01000020
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 4190
End posion on genome 4107
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
attttagcaT
tRNA gene sequence
GCCTCGGTCGCATAGTGGTTATTGCACCGGATTGCTAATCCGGGCCCTTCGGGGCTCGCA
GGTTCAATTCCTGCCCGAGGCGTtt
Downstream region at tRNA end position
attttattca
Secondary structure (Cloverleaf model)
>W1910765762	Ser	GCT
                   T      GTtt attttattca
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     G - C
                     G - C          T T
                    T     C G T C C     A
      T G A        C      | | | | |     A
    G       T A C G       G C A G G     C
    G         | | |                 T T
    T       T T G C
      T A          A     GCCCTTCGGGGCTC
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  T       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK