The detailed information of tRNA gene sequence


Sequence ID>W1910765765
Genome IDMNVV01000026
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 20157
End posion on genome 20228
Amino Acid Arg
Anticodon TCG
Upstream region at tRNA start position
ttcaaaatta
tRNA gene sequence
GGGCCTATAGTTCAACGGATAGAATATCGGGTTTCGGCCCCGAAGATCTAGGTTCGATTC
CTAGTAGGTTCGtta
Downstream region at tRNA end position
aaaatgaaag
Secondary structure (Cloverleaf model)
>W1910765765	Arg	TCG
                   a      Gtta aaaatgaaag
                     G - C
                     G + T
                     G + T
                     C - G
                     C - G
                     T - A
                     A - T          T T
                    T     G A T C C     A
      C A A        A      | | | | |     G
    G       C T T G       C T A G G     C
    G       | | | +                 T T
    A       G A A T
      T A          A     AGAT
                    T - A
                    C - G
                    G - C
                    G - C
                    G - C
                  T       C
                  T       G
                    T C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK