The detailed information of tRNA gene sequence


Sequence ID>W1910765768
Genome IDMNVV01000029
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_30_18 (MNVV)
Start position on genome 42518
End posion on genome 42594
Amino Acid Lys
Anticodon CTT
Upstream region at tRNA start position
aattatttaT
tRNA gene sequence
GGCTCTGTAGCTCAGCTTGGTTAGAGCACTGGACTCTTAATCCAGGTGTCGAGGGTTCAA
ATCCCTTCAGGGCCATtt
Downstream region at tRNA end position
tttaaaattg
Secondary structure (Cloverleaf model)
>W1910765768	Lys	CTT
                   T      ATtt tttaaaattg
                     G - C
                     G - C
                     C - G
                     T + G
                     C - G
                     T - A
                     G - C          T A
                    T     T T C C C     A
    T C G A        A      + | | | |     A
  T         C T C G       G A G G G     C
  G         | | | |                 T T
  G         G A G C
    T T A          A     GTGTC
                    C - G
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    C T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK