The detailed information of tRNA gene sequence


Sequence ID>W1910765775
Genome IDMNVW01000005
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 26024
End posion on genome 25954
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
tattaaaaac
tRNA gene sequence
GGGCCTGTAGTTCAACGGTAGAATGTTTCCTTCGCAGGGAAAAGATTTGAGTTCAATTCT
CAGCAGGTCCAtaa
Downstream region at tRNA end position
aaccagttaa
Secondary structure (Cloverleaf model)
>W1910765775	Ala	CGC
                   c      Ataa aaccagttaa
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     T - A
                     G - C          T T
                    T     G A C T C     A
        A A        A      + | | | |     A
      C     C T T G       T T G A G     C
      G     | | | +                 T T
      G     G A A T
        T A        G     AGAT
                    T - A
                    T - A
                    T - A
                    C - G
                    C - G
                  T       G
                  T       A
                    C G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK