The detailed information of tRNA gene sequence


Sequence ID>W1910765776
Genome IDMNVW01000007
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 53
End posion on genome 126
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gtgttcatat
tRNA gene sequence
TGCCAGGTCGTCTAACGGTAGGACAGCGGCCTTTGAAGCCGTGAATTGGGGTTCGATTCC
CTACCTGGCAGCCA
Downstream region at tRNA end position
agtttcagaa
Secondary structure (Cloverleaf model)
>W1910765776	Gln	TTG
                   t      GCCA agtttcagaa
                     T - A
                     G - C
                     C - G
                     C - G
                     A - T
                     G - C
                     G - C          T T
                    T     A T C C C     A
        A A        C      | + | | |     G
      C     T C T G       T G G G G     C
      G     + | | |                 T T
      G     G G A C
        T A        A     GAAT
                    G + T
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK