The detailed information of tRNA gene sequence


Sequence ID>W1910765779
Genome IDMNVW01000013
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 51212
End posion on genome 51136
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
gatataacaC
tRNA gene sequence
GCTCCCGTAACTCAGCCTGGATAGAGTGCCAGCCTTCTAAGCTGGAAGTCGCAGGTTCAA
ATCCTGTCGGGAGCGTta
Downstream region at tRNA end position
caggatttgg
Secondary structure (Cloverleaf model)
>W1910765779	Arg	TCT
                   C      GTta caggatttgg
                     G - C
                     C - G
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T G T C C     A
    C C G A        A      + | | | |     A
  T         C T C A       G C A G G     C
  G         | | | |                 T T
  G         G A G T
    A T A          G     AAGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    T C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK