The detailed information of tRNA gene sequence


Sequence ID>W1910765780
Genome IDMNVW01000013
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 50998
End posion on genome 50926
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
tcaaaatgaA
tRNA gene sequence
GCAGGAGTGGCAGAATGGTTATGCGCTCGCCTGCAGAGCGAGTTAATCGGGTTCAATTCC
CGGCTCCTGCTTtt
Downstream region at tRNA end position
tcatcagaaa
Secondary structure (Cloverleaf model)
>W1910765780	Cys	GCA
                   A      TTtt tcatcagaaa
                     G - C
                     C - G
                     A - T
                     G - C
                     G - C
                     A - T
                     G - C          T T
                    T     G G C C C     A
        A A        G      + | | | |     A
      T     G A C G       T C G G G     C
      G       | | |                 T T
      G     A T G C
        T T        G     TTAA
                    C - G
                    T - A
                    C - G
                    G - C
                    C - G
                  C       A
                  T       G
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK