The detailed information of tRNA gene sequence


Sequence ID>W1910765781
Genome IDMNVW01000013
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 33859
End posion on genome 33787
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
aatttagtaT
tRNA gene sequence
GGGCCTGTAGTTCAACGGTAGAATACGAGGCTGGCAGTCTTGAGATTCGGGTTCGATTCC
CGGCAGGTCCATtt
Downstream region at tRNA end position
tgttcaaaaa
Secondary structure (Cloverleaf model)
>W1910765781	Ala	GGC
                   T      ATtt tgttcaaaaa
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     T - A
                     G - C          T T
                    T     G G C C C     A
        A A        A      + | | | |     G
      C     C T T G       T C G G G     C
      G     | | | +                 T T
      G     G A A T
        T A        A     AGAT
                    C - G
                    G + T
                    A - T
                    G - C
                    G + T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK