The detailed information of tRNA gene sequence


Sequence ID>W1910765782
Genome IDMNVW01000013
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 30399
End posion on genome 30327
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ttatttatga
tRNA gene sequence
GCCGGTTTAACTCAGTTGGTAGAGTGCTGCTCTCATAAGGCAGATGTCCTGGGTTCGACT
CCCAGAACCGGCAtta
Downstream region at tRNA end position
aaataattaa
Secondary structure (Cloverleaf model)
>W1910765782	Met	CAT
                   a      Atta aaataattaa
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     T - A
                     T - A          T C
                    T     G A C C C     A
      T G A        A      | | | | |     G
    T       C T C A       C T G G G     C
    G       | | | |                 T T
    G       G A G T
      T A          G     ATGTC
                    C - G
                    T - A
                    G - C
                    C - G
                    T + G
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK