The detailed information of tRNA gene sequence


Sequence ID>W1910765783
Genome IDMNVW01000015
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 7556
End posion on genome 7483
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
atatgtttaC
tRNA gene sequence
GCTCGCATGGTGCAACGGTTAACATTCAGCCCTGTCACGGCTGCGAACCGGGTTCGAATC
CCGGTGCGGGCGTtc
Downstream region at tRNA end position
taaaattcaa
Secondary structure (Cloverleaf model)
>W1910765783	Asp	GTC
                   C      GTtc taaaattcaa
                     G - C
                     C - G
                     T + G
                     C - G
                     G - C
                     C - G
                     A - T          T A
                    T     G G C C C     A
      C A A        G      | | | | |     G
    G       C G T G       C C G G G     C
    G         | | +                 T T
    T       A C A T
      T A          T     CGAA
                    C - G
                    A - T
                    G - C
                    C - G
                    C - G
                  C       C
                  T       A
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK