The detailed information of tRNA gene sequence


Sequence ID>W1910765784
Genome IDMNVW01000021
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 4479
End posion on genome 4553
Amino Acid Glu
Anticodon TTC
Upstream region at tRNA start position
attaacaaaT
tRNA gene sequence
GCCCCTATGGTGTAGAGGCCAAGCATCCAGCCCTTTCAAGGCTGAGACCCGAGTTCGAAT
CTCGGTGGGGGCATta
Downstream region at tRNA end position
aatatcccca
Secondary structure (Cloverleaf model)
>W1910765784	Glu	TTC
                   T      ATta aatatcccca
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     T + G
                     A - T          T A
                    T     G G C T C     A
      A G A        G      | | | | |     G
    G       T G T G       C C G A G     C
    G       + | | +                 T T
    C       G C A T
      C A A        C     AGAC
                    C - G
                    A - T
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK