The detailed information of tRNA gene sequence


Sequence ID>W1910765785
Genome IDMNVW01000021
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 27208
End posion on genome 27283
Amino Acid Asn
Anticodon GTT
Upstream region at tRNA start position
gactatatcT
tRNA gene sequence
GCCCTGGTAGCTCAGTTGGTAGAGCATACGACTGTTAATCGTAGGGTCGCAGGTTCAAAT
CCTGTCCGGGGCGTCa
Downstream region at tRNA end position
acaaaaatca
Secondary structure (Cloverleaf model)
>W1910765785	Asn	GTT
                   T      GTCa acaaaaatca
                     G - C
                     C - G
                     C - G
                     C - G
                     T + G
                     G - C
                     G - C          T A
                    T     T G T C C     A
      T G A        A      + | | | |     A
    T       C T C G       G C A G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     GGGTC
                    T - A
                    A - T
                    C - G
                    G - C
                    A - T
                  C       A
                  T       A
                    G T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK