The detailed information of tRNA gene sequence


Sequence ID>W1910765787
Genome IDMNVW01000021
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 57144
End posion on genome 57072
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
aaatgttatG
tRNA gene sequence
GCGAATGTAGCGTAATGGTAGCGTTCACGACTGTGGCTCGTGAGGAGTGGGTTCAATTCC
CACCTTTCGCCCtt
Downstream region at tRNA end position
aaactttttc
Secondary structure (Cloverleaf model)
>W1910765787	His	GTG
                   G      CCtt aaactttttc
                     G - C
                     C - G
                     G - C
                     A - T
                     A - T
                     T   T
                     G - C          T T
                    T     C A C C C     A
        A A        A      | | | | |     A
      T     T G C G       G T G G G     C
      G     + | | +                 T T
      G     G C G T
        T A        T     AGGA
                    C - G
                    A - T
                    C - G
                    G - C
                    A - T
                  C       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK