The detailed information of tRNA gene sequence


Sequence ID>W1910765789
Genome IDMNVW01000026
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 46326
End posion on genome 46251
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gtatatttaa
tRNA gene sequence
GCTCCCGTAGCTCAGTTGGATTAGAGCATCTCCGTCCTAAGGAGAGGGTCGCAGGTTCAA
GTCCTGTCGGGAGCGCtt
Downstream region at tRNA end position
attttaagcc
Secondary structure (Cloverleaf model)
>W1910765789	Arg	CCT
                   a      GCtt attttaagcc
                     G - C
                     C - G
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T G
                    T     T G T C C     A
    T T G A        A      + | | | |     A
  G         C T C G       G C A G G     C
  G         | | | |                 T T
  A         G A G C
    T T A          A     GGGTC
                    T - A
                    C - G
                    T - A
                    C - G
                    C - G
                  G       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK