The detailed information of tRNA gene sequence


Sequence ID>W1910765790
Genome IDMNVW01000034
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 16027
End posion on genome 16098
Amino Acid Arg
Anticodon GCG
Upstream region at tRNA start position
gggttgataa
tRNA gene sequence
GCCCCCATAGTTCAGTGGATAGAATGTTTCCTTGCGGAGGAAATGATTCCGGTTCGAGTC
CGGATGGGGGCAttc
Downstream region at tRNA end position
catggttcaa
Secondary structure (Cloverleaf model)
>W1910765790	Arg	GCG
                   a      Attc catggttcaa
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     C - G
                     A - T          T G
                    T     A G G C C     A
      T G A        A      | | | | |     G
    G       C T T G       T C C G G     C
    G       | | | +                 T T
    A       G A A T
      T A          G     TGAT
                    T - A
                    T - A
                    T - A
                    C - G
                    C - G
                  T       A
                  T       G
                    G C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK