The detailed information of tRNA gene sequence


Sequence ID>W1910765791
Genome IDMNVW01000034
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 977
End posion on genome 906
Amino Acid Thr
Anticodon CGT
Upstream region at tRNA start position
aaacattaac
tRNA gene sequence
GCCTCTGTAGCTCAGTGGTAGAGCATCTGCTTCGTAAGCAGGGGGTCACAGGTTCAAGTC
CTGTCAGGGGCTttg
Downstream region at tRNA end position
attctttttt
Secondary structure (Cloverleaf model)
>W1910765791	Thr	CGT
                   c      Tttg attctttttt
                     G - C
                     C - G
                     C - G
                     T + G
                     C - G
                     T - A
                     G - C          T G
                    T     T G T C C     A
        G A        A      | | | | |     A
      T     C T C G       A C A G G     C
      G     | | | |                 T T
      G     G A G C
        T A        A     GGGTC
                    T + G
                    C - G
                    T - A
                    G - C
                    C - G
                  T       A
                  T       A
                    C G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK