The detailed information of tRNA gene sequence


Sequence ID>W1910765792
Genome IDMNVW01000036
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 42134
End posion on genome 42061
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
acataatcaa
tRNA gene sequence
GGGCCCATGGTCCAGTGGTCTAAGACGTCTCGTTTACACCGAGAAGGTCGGAGGTTCGAA
CCCTCCTGGGCCCAtga
Downstream region at tRNA end position
ggaatttgac
Secondary structure (Cloverleaf model)
>W1910765792	Val	TAC
                   a      Atga ggaatttgac
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T          C A
                    T     C C T C C     A
      T G A        G      | | | | |     G
    G       C C T G       G G A G G     C
    G         | | |                 T T
    T       A G A C
      C T A        G     AGGTC
                    T - A
                    C - G
                    T - A
                    C - G
                    G - C
                  T       C
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK