The detailed information of tRNA gene sequence


Sequence ID>W1910765793
Genome IDMNVW01000036
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 38953
End posion on genome 38881
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
tttcacgtaT
tRNA gene sequence
GCGCTGGTAGTATAGTGGTAGTATACATCCCTGCCACGGATGTGACCCGAGTTCGACTCT
CGGCTAGCGCATtc
Downstream region at tRNA end position
tacaactttt
Secondary structure (Cloverleaf model)
>W1910765793	Gly	GCC
                   T      ATtc tacaactttt
                     G - C
                     C - G
                     G - C
                     C - G
                     T - A
                     G + T
                     G - C          T C
                    T     G G C T C     A
        G A        A      | | | | |     G
      T     T A T G       C C G A G     C
      G     + | | +                 T T
      G     G T A T
        T A        A     TGAC
                    C - G
                    A - T
                    T - A
                    C - G
                    C - G
                  C       C
                  T       A
                    G C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK