The detailed information of tRNA gene sequence


Sequence ID>W1910765794
Genome IDMNVW01000047
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_31_27 (MNVW)
Start position on genome 5053
End posion on genome 4970
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
aagaaatatT
tRNA gene sequence
GCCGCAGTGGCCCAATGGTAAGGCGCAAGCCTGGAAAGCTTGTTTCCGCAAGGATATTCA
GGTTCGATTCCTGGCTGCGGCGTta
Downstream region at tRNA end position
attaaaatga
Secondary structure (Cloverleaf model)
>W1910765794	Ser	GGA
                   T      GTta attaaaatga
                     G - C
                     C - G
                     C - G
                     G - C
                     C - G
                     A - T
                     G - C          T T
                    T     G G T C C     A
        A A        G      + | | | |     G
      T     C C C G       T C A G G     C
      G       | | |                 T T
      G     A G G C
        T A        G     TTTCCGCAAGGATAT
                    C - G
                    A - T
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    G G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK