The detailed information of tRNA gene sequence


Sequence ID>W1910765796
Genome IDMNVX01000006
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 54
End posion on genome 130
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
attttattaT
tRNA gene sequence
GCGCCCGTAGCTCAGCCTGGATAGAGCAGTGGGGTCCTAACCCAAAGGTCGAAGGTTCAA
ATCCTTTCGGGCGCGTat
Downstream region at tRNA end position
actggatttg
Secondary structure (Cloverleaf model)
>W1910765796	Arg	CCT
                   T      GTat actggatttg
                     G - C
                     C - G
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T T T C C     A
    C C G A        A      + | | | |     A
  T         C T C G       G A A G G     C
  G         | | | |                 T T
  G         G A G C
    A T A          A     AGGTC
                    G   A
                    T - A
                    G - C
                    G - C
                    G - C
                  G       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK