The detailed information of tRNA gene sequence


Sequence ID>W1910765797
Genome IDMNVX01000006
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 238
End posion on genome 310
Amino Acid Gly
Anticodon TCC
Upstream region at tRNA start position
tataaattaT
tRNA gene sequence
GCACCGGTGGTTTAATGGTAGAATCTCTCGCTTCCAACGAGATGACCCGGGTTCGATTCC
CGGCTGGTGCATtt
Downstream region at tRNA end position
gtttttctat
Secondary structure (Cloverleaf model)
>W1910765797	Gly	TCC
                   T      ATtt gtttttctat
                     G - C
                     C - G
                     A - T
                     C - G
                     C - G
                     G + T
                     G - C          T T
                    T     G G C C C     A
        A A        G      | | | | |     G
      T     T T T G       C C G G G     C
      G     + | | +                 T T
      G     G A A T
        T A        C     TGAC
                    T - A
                    C - G
                    T - A
                    C - G
                    G - C
                  C       A
                  T       A
                    T C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK