The detailed information of tRNA gene sequence


Sequence ID>W1910765798
Genome IDMNVX01000011
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 10755
End posion on genome 10840
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
tcttttttaT
tRNA gene sequence
GCGGGAGTGCCGGAGCGGTCAAACGGGATAGGTTTAGGACCTATTAGCTTAGTGCTTACA
CAGGTTCGAATCCTGTCTCCCGCATtt
Downstream region at tRNA end position
aggatttgtg
Secondary structure (Cloverleaf model)
>W1910765798	Leu	TAG
                   T      ATtt aggatttgtg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T
                     G - C          T A
                    T     T G T C C     A
      C G A        G      | | | | |     G
    G       G G C C       A C A G G     C
    G         | | |                 T T
    T       A C G G
      C A A        G     TAGCTTAGTGCTTAC
                    A - T
                    T - A
                    A - T
                    G - C
                    G - C
                  T       A
                  T       G
                    T A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK