The detailed information of tRNA gene sequence


Sequence ID>W1910765800
Genome IDMNVX01000021
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 19443
End posion on genome 19525
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
tgtaagtaaT
tRNA gene sequence
GCCGACATCGCATAGTGGTATTGCAACTGGCTTGAGACCAGTGCCCTTCGGGGCCCCCCG
GTTCGATTCCGGGTGTCGGCGTta
Downstream region at tRNA end position
acaacttttc
Secondary structure (Cloverleaf model)
>W1910765800	Ser	TGA
                   T      GTta acaacttttc
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     C - G
                     A - T          T T
                    T     G G G C C     A
        G A        C      | | | | |     G
      T     T A C G       C C C G G     C
      G       | | |                 T T
      G     T T G C
        T A        A     GCCCTTCGGGGCCC
                    A - T
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       G
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK