The detailed information of tRNA gene sequence


Sequence ID>W1910765801
Genome IDMNVX01000021
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 9391
End posion on genome 9316
Amino Acid Pro
Anticodon TGG
Upstream region at tRNA start position
cttttattaT
tRNA gene sequence
GGGGTCGTAGTATAGCCTGGCTAGTATCCGAGGTTTGGGACTTCGTGACCCCGGTTCAAA
TCCGGGCGACCCCATtt
Downstream region at tRNA end position
caaatatatt
Secondary structure (Cloverleaf model)
>W1910765801	Pro	TGG
                   T      ATtt caaatatatt
                     G - C
                     G - C
                     G - C
                     G - C
                     T - A
                     C - G
                     G - C          T A
                    T     G G G C C     A
    C C G A        A      | | | | |     A
  T         T A T G       C C C G G     C
  G         + | | +                 T T
  G         G T A T
    C T A          C     TGAC
                    C - G
                    G - C
                    A - T
                    G + T
                    G - C
                  T       A
                  T       G
                    T G G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK