The detailed information of tRNA gene sequence


Sequence ID>W1910765802
Genome IDMNVX01000023
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 9256
End posion on genome 9330
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
aagacaataa
tRNA gene sequence
GGATCCATAGCTCAGTCTGGTTAGAGCACTGGCCTTTTAAGCCAGGTGTCGGGGGTTCAA
ATCCCTCTGGGTCCAttt
Downstream region at tRNA end position
aggatttgtg
Secondary structure (Cloverleaf model)
>W1910765802	Lys	TTT
                   a      Attt aggatttgtg
                     G - C
                     G - C
                     A - T
                     T + G
                     C - G
                     C - G
                     A - T          T A
                    T     C T C C C     A
    C T G A        A      | + | | |     A
  T         C T C G       G G G G G     C
  G         | | | |                 T T
  G         G A G C
    T T A          A     GTGTC
                    C - G
                    T - A
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK