The detailed information of tRNA gene sequence


Sequence ID>W1910765803
Genome IDMNVX01000023
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 5295
End posion on genome 5224
Amino Acid Arg
Anticodon GCG
Upstream region at tRNA start position
ttattttaga
tRNA gene sequence
GCCCTTATAGTTTAACGGATAGAATGCTTCGTTGCGGTCGAAGTGATCGAGGTTCAATTC
CTCGTGGGGGCGttg
Downstream region at tRNA end position
aaccagctat
Secondary structure (Cloverleaf model)
>W1910765803	Arg	GCG
                   a      Gttg aaccagctat
                     G - C
                     C - G
                     C - G
                     C - G
                     T + G
                     T + G
                     A - T          T T
                    T     G C T C C     A
      C A A        A      | | | | |     A
    G       T T T G       C G A G G     C
    G       + | | +                 T T
    A       G A A T
      T A          G     TGAT
                    C - G
                    T - A
                    T - A
                    C - G
                    G - C
                  T       T
                  T       G
                    G C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK