The detailed information of tRNA gene sequence


Sequence ID>W1910765804
Genome IDMNVX01000029
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 199
End posion on genome 129
Amino Acid Ala
Anticodon TGC
Upstream region at tRNA start position
attagactaa
tRNA gene sequence
GGGCCTGTAGTCTAGTGGCAGAATACGTCGTTTGCAACGATGAGACCTGGGTTCGATTCC
CGGCAGGTCCAttt
Downstream region at tRNA end position
tataaataca
Secondary structure (Cloverleaf model)
>W1910765804	Ala	TGC
                   a      Attt tataaataca
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     T - A
                     G - C          T T
                    T     G G C C C     A
        G A        A      | + | | |     G
      T     T C T G       C T G G G     C
      G     +   | +                 T T
      G     G A A T
        C A        A     AGAC
                    C - G
                    G + T
                    T - A
                    C - G
                    G - C
                  T       A
                  T       A
                    T G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK