The detailed information of tRNA gene sequence


Sequence ID>W1910765805
Genome IDMNVX01000032
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 4865
End posion on genome 4948
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
ttttttataa
tRNA gene sequence
GCGGGAGTGCCGGAGTGGTCAAACGGGCAGGACTTAAGATCCTGTGGCTTAGTGCCTACG
TAGGTTCGAACCCTATCTCCCGCAttt
Downstream region at tRNA end position
agggtttgat
Secondary structure (Cloverleaf model)
>W1910765805	Leu	TAA
                   a      Attt agggtttgat
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T
                     G - C          C A
                    T     T A T C C     A
      T G A        G      + | | | |     G
    G       G G C C       G T A G G     C
    G         | | |                 T T
    T       A C G G
      C A A        G     TGGCTTAGTGCCTAC
                    C - G
                    A - T
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK