The detailed information of tRNA gene sequence


Sequence ID>W1910765807
Genome IDMNVX01000034
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 7632
End posion on genome 7703
Amino Acid Arg
Anticodon TCG
Upstream region at tRNA start position
ttgtctttag
tRNA gene sequence
GGGCCTATAGTTCAACGGATAGAATAACAGGTTTCGGCCCTGTTGATCTGGGTTCGATTC
CTAGTAGGCCCGtaa
Downstream region at tRNA end position
tgtttttaat
Secondary structure (Cloverleaf model)
>W1910765807	Arg	TCG
                   g      Gtaa tgtttttaat
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     A - T          T T
                    T     G A T C C     A
      C A A        A      | | + | |     G
    G       C T T G       C T G G G     C
    G       | | | +                 T T
    A       G A A T
      T A          A     TGAT
                    A - T
                    C - G
                    A - T
                    G - C
                    G - C
                  T       C
                  T       G
                    T C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK