The detailed information of tRNA gene sequence


Sequence ID>W1910765810
Genome IDMNVX01000036
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_32_21 (MNVX)
Start position on genome 43277
End posion on genome 43349
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
agtattctgt
tRNA gene sequence
GCGGGGATGGCACAGTGGCTACTGCGTTCGCCTGCAGAGCGAATTTTCCCGGGTTCGAAT
CCCGGTCCCCGCTtat
Downstream region at tRNA end position
aatttatttt
Secondary structure (Cloverleaf model)
>W1910765810	Cys	GCA
                   t      Ttat aatttatttt
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     G G C C C     A
      T G A        G      | | | | |     G
    G       C A C G       C C G G G     C
    G         | | |                 T T
    C       C T G C
      T A          G     TTTTC
                    T - A
                    T - A
                    C - G
                    G - C
                    C - G
                  C       A
                  T       G
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK